Анализ структуры промоторной области гена



Pdf көрінісі
Дата14.10.2018
өлшемі50.1 Kb.

ВЕСТНИК ВГУ, СЕРИЯ: ХИМИЯ. БИОЛОГИЯ. ФАРМАЦИЯ, 2017, № 4

78

УДК 577.1



АНАЛИЗ СТРУКТУРЫ ПРОМОТОРНОЙ ОБЛАСТИ  ГЕНА 

FUM2

 ФУМАРАТГИДРАТАЗЫ КУКУРУЗЫ ZEA MAYS L.

Д. Н. Федорин, М. А. Добычина, А. Т. Епринцев

ФГБОУ ВО «Воронежский государственный университет»

Поступила в редакцию 12.05.2017 г.



Аннотация. В результате анализа структуры промотора гена fum2 фумаратгидратазы (ФГ, КФ 

4.2.1.2) установлено, что в его составе отсутствуют CрG-островки, что может обуславливать его 

регуляцию за счет изменения статуса метилирования отдельных CG-динуклеотидов. Механизм ре-

гуляции гена fum2 связан с зависимостью связывания транскрипционных факторов от наличия ме-

тилированных цитозинов в специфических сайтах их связывания. На основании данного анализа 

нами были разработаны праймеры для метилспецифичной ПЦР.



Ключевые слова: фумаратгидратаза, промотор, ген, метилирование ДНК, CpG-островок, ме-

тилспецифичная полимеразная цепная реакция



Abstract. As  a  result  of  the  analysis  of  the  structure  of  the  promoter  of  the  gene  fum2  fumarate 

hydratase  (FH,  EC  4.2.1.2),  it  was  found  that  there  are  no  CpG  islands  in  its  composition,  which  can 

cause its regulation by changing the methylation status of individual CG dinucleotides. The mechanism of 

regulation of the fum2 gene is associated with the dependence of the binding of transcription factors on the 

presence of methylated cytosines in specific sites of their binding. Based on this analysis, we developed 

primers for methyl-specific PCR.



Keywords: fumarate hydratase, promoter, gene, DNA methylation, CpG-island, methyl-specific poly-

merase chain reaction

© Федорин Д. Н., Добычина М. А., Епринцев А. Т., 2017

Одним из ферментов, играющих важную роль 

в окислительных процессах клетки является фу-

маратгидратаза.  Данный  фермент  катализирует 

обратимую гидратацию фумарата в L-малат, обе-

спечивая  протекание  цикла  трикарбоновых  кис-

лот. Скорость функционирования ФГ, в частности 

прямой реакции, является показателем интенсив-

ности функционирования цикла Кребса [1]. Одна-

ко, более важным показателем работы фермента 

является содержание его транскриптов.

Анализ  генетических  баз  данных  и  источни-

ков  литературы  показал,  что  в  геноме  кукурузы 

имеется  два  гена  fum1  и  fum2,  кодирующих  ФГ 

[2].  При  этом,  ген  fum2  кодирует  цитозольную 

форму фермента, участвующую в анаплеротиче-

ских  реакциях  и  обеспечивающую  адаптивную 

реакцию организма [3]. Ранее было показано, что 

в процессе прорастания семян в щитках кукуру-

зы уровень экспрессии гена fum1 снижается, что 

способствует ферменту поддерживать гомеостаз в 

стрессовых условиях. Одним из механизмов, из-

меняющих  функционирование  фермента,  может 

выступать  контроль  скорости  продукции  мРНК 

гена за счет изменения метилирования промотор-

ной области ДНК. Данная эпигенетичекая моди-

фикация  является  уникальной,  поскольку  имеет 

динамический характер и наследуется, обеспечи-

вая  основу  для  регулирования  экспрессии  генов 

[4]. В соматических клетках метилирование ДНК 

путем ковалентного добавления метильной груп-

пы  (-СН


3

)  к  цитозину  обнаруживается  наиболее 

часто  в контексте CpG-сайта [5]. В связи с этим 

целью  данной  работы  являлся  анализ  промотор-

ного участка гена fum2 на наличие CpG-сайтов и 

разработка  метил-специфичных  праймеров  для 

оценки  статуса  метилирования  отдельных  CG-

динуклеотидов его промотора.



МЕТОДИКА ЭКСПЕРИМЕНТА

 Для анализа промотора гена fum2 на наличие 

CpG-островков и подбора праймеров для метил-

специфичной ПЦР была использована программа  

MethPrimer  (http://www.urogene.org/methprimer/

index1.html).  Нуклеотидная  последовательность 



ВЕСТНИК ВГУ, СЕРИЯ: ХИМИЯ. БИОЛОГИЯ. ФАРМАЦИЯ, 2017, № 4

79

Анализ структуры промоторной области

промоторной  области  фумаратгидратазы  кукуру-

зы была взята из базы данных NCBI (США, http://

www.ncbi.nlm.nih.gov/). 

Для  множественного  выравнивания  несколь-

ких  нуклеотидных  последовательностей,  выяв-

ленных  для  гена  fum2,  использовали  программу 

Global Alignment (Needleman-Wunsch Global Align 

Nucleotide  Sequences,  https://www.ncbi.nlm.nih.

gov/blast/). 

Поиск  гомологичных  последовательностей  с 

известными  последовательностями  генов  фума-

ратгидратазы в базе данных GenBank осуществля-

ли  с  помощью  программы  BLAST  (https://www.

ncbi.nlm.nih.gov/blast/).



ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

Ранее было показано, что при прорастании се-

мян наблюдается изменение скорости транскрип-

ции фумаразных генов кукурузы [2, 6]. Одним из 

механизмов, способствующих  этому, может вы-

ступать  модификация  статуса  метилирования  их 

промоторов [7]. С целью выяснения роли эпигене-

тического механизма в регуляции скорости функ-

ционирования  генов  фумаразы,  нами  была  про-

анализирована нуклеотидная последовательность 

мРНК гена fum2 кукурузы (BT066275.1), взятой из 

международной базы данных GeneBank. На осно-

вании анализа нуклеотидной последовательности 

хромосомы 7 кукурузы был найден промотор гена 



fum2 (NC_024465.2 (83422659…83424922), коди-

рующего  цитозольную  форму  фумаратгидратазы 

кукурузы (рис 1).

В ходе анализа нуклеотидной последователь-

ности  промотора  гена  fum2  выявлено,  что  CG-

динуклеотиды расположены равномерно по всей 

его  длине  и  CpG-островков  не  обнаружено.  От-

сутствие CpG-островков в промоторе гена имеет 

существенное значение, поскольку в данном слу-

чае метилирование каждого конкретного цитозина 

играет роль в регуляции экспрессии гена. Данное 

наблюдение  объясняется  зависимостью  связы-

вания  транскрипционных  факторов  от  наличия 

метилированных цитозинов в сайтах связывания. 

Этот феномен был описан для такого широко рас-

пространенного транскрипционного фактора как 

AP–2  [8].  Зависимость  эффективности  связыва-

ния от статуса метилирования была предположе-

на и для транскрипционного фактора Sp1, однако 

в этом случае данные остаются противоречивыми 

[9]. Другой механизм регуляции транскрипции на 

основании  метилирования  отдельных  цитозинов 

базируется  на  активности  метил-связывающих-

ся  белков  –  MDBPs.  Первый  описанный  белок 

этого  семейства  –  MeCP1,  обнаруженный  Мее-

ханом (Meehan) с коллегами связывается в ДНК 

при наличии не менее 7–и метилированных CpG-

динуклеотидов, и поэтому не может играть важ-

ной роли в регуляции экспрессии генов, не имею-

щих CpG-островка в промоторе [10].

 Исследование структуры гена fum1 выявило 

наличие  одного  CpG-островка  в  его  промоторе 

(рис 2), что может обуславливать его регуляцию  

за счет изменения степени его метилирования. 

Анализ  промоторной  последовательности 

гена  fum2  позволил  разработать  набор  прайме-

ров  для  проведения  метилспецифичной  ПЦР  и 

анализа  степени  метилирования  отдельных  CG-

динуклеотидов в его составе (табл. 1).

Рис. 1. Промоторная последовательность гена fum2 из щитков семян кукурузы. Стрелками (>) обо-

значены положения праймеров для метил-специфичной ПЦР.


ВЕСТНИК ВГУ, СЕРИЯ: ХИМИЯ. БИОЛОГИЯ. ФАРМАЦИЯ, 2017, № 4

80

Федорин Д. Н., Добычина М. А., Епринцев А. Т.



Рис. 2. Анализ CG-динуклеотидов в составе промотора гена fum2 Z. mays. Вертикальными линиями 

указаны положения CG-динуклеотидов. Голубым выделен CpG-островок.

Таблица 1.

Олигонуклеотиды к промотору гена fum2 для метилспецифичной ПЦР 

Ген


Положение исследуемого 

цитозина


Название

Последовательность

fum2

I

-778 нукл.



прямой М

5’- TAATTAAAATTCCAAATAGCTTGCA -3’

обратный М

5’- TGAAAATTATTTGTGGTGTTGG -3’

прямой U

5’- AAATTCCAAATAGCTTGCA -3’

обратный U

5’- AAAATTATTTGTGGTGTTGG -3’

II

-717 нукл.



прямой М

5’- TTCATTTCATATACAATCCGCA -3’

обратный М

5’- TGAAAATTATTTGTGGTGTTGG -3’

прямой U

5’- TTCATTTCATATACAATCCACA -3'

обратный U

5’- AAAATTATTTGTGGTGTTGG -3’

IIII -552 нукл.

прямой М


5’- AAAATATACCTTACACAAAAATAAGCA -3’

обратный М

5’- TGAAAATTATTTGTGGTGTTGG -3’

прямой U


 5’- AAAATATACCTTACACAAAAATAAACA -3’

обратный U

5’- AAAATTATTTGTGGTGTTGG -3’

ЗАКЛЮЧЕНИЕ

На  основании  проведенного  исследования 

методами  биоинформатики  были  проанализиро-

ваны  мРНК,  ген  fum2  кукурузы  и  его  промотор, 

на  основе  нуклеотидных  последовательностей, 

представленных  в  международной  базе  данных 

GenBank. В составе промоторной области не об-

наружено  CpG-островков,  что  может  обуславли-

вать его регуляцию за счет изменения степени его 

метилирования  отдельных  CG-динуклеотидов, 

играющих важную роль в работе гена за счет кон-

троля его взаимодействия с транскрипционными 

факторами.

Работа выполнена при финансовой поддержке Российского на-

учного фонда (РНФ, грант №14-14-00721).

СПИСОК ЛИТЕРАТУРЫ

1.  Ленинджер  А.  Биохимия  /  А.  Ленинджер, 

1976. – 489 c.

2. Expression and properties of the mitochondri-

al  and  cytosolic  forms  of  fumarase  in  germinating 

maize  seeds  / A.T.  Eprintsev  [et  al.]  //  Physiologia 

Plantarum. - 2014. - V. 152. - P. 231–240.

3. Dual localization of fumarase is dependent on 

the integrity of the glyoxylate shunt / N. Regev-Rudz-

ki [et al.] // Molecular Microbiology. – 2009. – V. 72, 

N. 2. – P. 297–306.

4.  Scott  V.  Epigenetic  Regulation  of  Gene 

Expression:  Emerging  Applications  for  Horses  / 

V.Scott  //  Journal  of  Equine  Vaterinary  Science.  - 

2013. - V.33. - Is.5. - P.288-294.

5. DNA cytosine methylation in plant development 

/ M. Zhang [et al.] // J Genet Genomics. – 2010. – V. 

37, N. 1. – P. 1-12.

6. Роль транскрипционных факторов в регуля-

ции  экспрессии  фумаратгидратазной  активности 

в кукурузе / Д.Н. Федорин [и др.] // Вестник ВГУ. 

Серия: Химия. Биология. Фармация. - 2015. - № 

4. - С. 80-84.

7. Monk M. Changes in DNA methylation during 

mouse  embryonic  development  in  relation  to  X–

chromosome  activity  and  imprinting  /  M.  Monk  // 

Philosophical  transactions  of  the  Royal  Society  of 

London B. Biological Science. – 1990. – V.326. – P. 

299–312.

8.  Comb  M.  CpG  methylation  inhibits 

proenkephalin  gene  expression  and  binding  of  the 

transcription factor AP–2 / M. Comb, H.M. Goodman 

// Nucleic Acids Research. – 1990. – V.18. – P. 3975–

3982.


ВЕСТНИК ВГУ, СЕРИЯ: ХИМИЯ. БИОЛОГИЯ. ФАРМАЦИЯ, 2017, № 4

81

9.  Clark  S.J.  Sp1  binding  is  inhibited  by 



(m)Cp(m)CpG methylation / S.J. Clark, J. Har-

rison,  P.L.  Molloy  //  Gene.  –  1997.  –  V.195. 

– P. 67–71.

10.  Identification  of  a  mammalian  protein  that 

binds  specifically  to  DNA  containing  methylated 

CpGs / R.R. Meehan [et al.] // Cell. – 1989. – V.58 – 



P. 499–507.

Анализ структуры промоторной области

Воронежский государственный университет

Федорин  Д.  Н.,  доцент  кафедры  биохимии  и 

физиологии клетки, 

Тел.: +7 (473)22-88-77

E-mail: rybolov@mail.ru

Добычина М. А., магистрант кафедры биохи-

мии и физиологии клетки, 

Тел.:  +7  (473)22-88-77

E-mail: mzenishheva@yandex.ru

Епринцев А. Т., заведующий кафедрой биохи-

мии и физиологии клетки, 

Тел.: +7 (473)22-88-77

E-mail: bc366@bio.vsu.ru

Voronezh State University

Fedorin  Dmitry  N.,  assistant  professor  of 

biochemistry and cell physiology,

Ph.:  +7 ( 473) 22-88-77

E-mail: rybolov@mail.ru

Dobychina  M.  A.,  post-graduate  student  of  the 

Department of Biochemistry and Cell Physiology

Ph.:  +7 ( 473) 22-88-77

E-mail: mzenishheva@yandex.ru 

Eprintsev  A.  T.,  head  of  the  department  of 

biochemistry and cell physiology

Ph.: +7 ( 473) 22-88-77 

E-mail: bc366@bio.vsu.ru



Достарыңызбен бөлісу:


©stom.tilimen.org 2019
әкімшілігінің қараңыз

    Басты бет